Chemical Imaging of Organic Materials by MeV SIMS Using a Continuous Collimated Ion Beam.

MeV SIMS is a type of secondary ion mass spectrometry (SIMS) technique where molecules are desorbed from the sample surface with ions of MeV energies. In this work, we present a novel system for molecular imaging of organic materials using a continuous analytical beam and a start trigger for timing based on the detection of secondary electrons. The sample is imaged by a collimated primary ion beam and scanning of the target with a lateral resolution of ∼20 µm. The mass of the analyzed molecules is determined with a reflectron-type time-of-flight (TOF) analyzer, where the START signal for the TOF measurement is generated by the secondary electrons emitted from a thin carbon foil (∼5 nm) placed over the beam collimator. With this new configuration of the MeV SIMS setup, a primary ion beam with the highest possible electronic stopping can be used (i.e., highest secondary molecular yield), and samples of any thickness can be analyzed. Since the electrons are collected from the thin foil rather than from the sample surface, the detection efficiency of secondary electrons is always the same for any type of analyzed material. Due to the ability to scan the samples by a piezo stage, samples of a few cm in surface size can be imaged. The imaging capabilities of MeV SIMS are demonstrated on crossing ink lines deposited on paper, a thin section of a mouse brain, and a fingerprint deposited on a thick Si wafer to show the potential application of the presented technique for analytical purposes in biology and forensic science.

Chronic High Fat Diet Intake Impairs Hepatic Metabolic Parameters in Ovariectomized Sirt3 KO Mice.

High fat diet (HFD) is an important factor in the development of metabolic diseases, with liver as metabolic center being highly exposed to its influence. However, the effect of HFD-induced metabolic stress with respect to ovary hormone depletion and sirtuin 3 (Sirt3) is not clear. Here we investigated the effect of Sirt3 in liver of ovariectomized and sham female mice upon 10 weeks of feeding with standard-fat diet (SFD) or HFD. Liver was examined by Folch, gas chromatography and lipid hydroperoxide analysis, histology and oil red staining, RT-PCR, Western blot, antioxidative enzyme and oxygen consumption analyses. In SFD-fed WT mice, ovariectomy increased Sirt3 and fatty acids synthesis, maintained mitochondrial function, and decreased levels of lipid hydroperoxides. Combination of ovariectomy and Sirt3 depletion reduced pparα, Scd-1 ratio, MUFA proportions, CII-driven respiration, and increased lipid damage. HFD compromised CII-driven respiration and activated peroxisomal ROS scavenging enzyme catalase in sham mice, whereas in combination with ovariectomy and Sirt3 depletion, increased body weight gain, expression of NAFLD- and oxidative stress-inducing genes, and impaired response of antioxidative system. Overall, this study provides evidence that protection against harmful effects of HFD in female mice is attributed to the combined effect of female sex hormones and Sirt3, thus contributing to preclinical research on possible sex-related therapeutic agents for metabolic syndrome and associated diseases.

Combination of sirtuin 3 and hyperoxia diminishes tumorigenic properties of MDA-MB-231 cells.

AIMS: Since the role of the major mitochondrial NAD+-dependent deacetylase, sirtuin 3 (Sirt3), is differential in cancer, opposite to the well-known tumor-suppressing effect of hyperoxia, this study aimed to investigate the role of Sirt3 in triple-negative breast cancer (TNBC) cell line MDA-MB-231 upon hyperoxic (95% O2) conditions. MAIN METHODS: MDA-MB-231 cells were stably transfected with Flag-tagged Sirt-3 or empty plasmid. Western blot and real-time PCR were used to monitor the expression of proteins or genes involved in mitochondrial biogenesis, metabolic regulation and antioxidant defense. Immunocytochemistry and confocal microscopy were used to confirm the cellular localization and abundance of proteins. Flow cytometry was used to analyze mitochondrial mass, potential and ROS production, and MTT test as a measure of metabolic activity. Mitotic index analysis, colony-forming unit assay, DNA damage and Annexin V-FITC analyses were used to assess the differences in the growth and apoptosis rate. KEY FINDINGS: Although Sirt3 seemed to improve mitochondrial properties by increasing mitochondrial mass and potential, metabolic activity (Warburg effect) and antioxidative defense (SOD2, Cat), it also increased mitochondrial ROS, induced DNA damage, timp-1 expression, formation of multinucleated cells and apoptosis, and finally markedly reduced the proliferation of MDA-MB-231 cells. All these effects were even more evident upon the hyperoxic treatment, thus pointing towards combined negative effect of Sirt3 and hyperoxia on MDA-MB-231 cells. SIGNIFICANCE: Both Sirt3 and hyperoxia, alone or in combination, have the potential to negatively affect the malignant properties of the MDA-MB-231 cells and should be further explored as a possible therapy for TNBC.

Study of the diacylglycerol composition in the liver and serum of mice with prediabetes and diabetes using MeV TOF-SIMS.

AIMS: Hepatic insulin resistance, induced by fat, occurs before peripheral resistance and leads to prediabetes and diabetes. If insulin resistance is detected earlier, lifestyle changes could prevent or delay disease development. Therefore, we analysed lipids in the liver and serum of prediabetic and diabetic mice by MeV TOF-SIMS with a focus on diacylglycerols (DAGs) as the best predictor of (liver) resistance. METHODS: Glucose impairment was spontaneously developed or induced by HFD in NOD/LtJ mice, and prediabetic and diabetic mice were selected according to their glucose levels. MeV TOF-SIMS was applied to image the lipid distribution in the liver and to relatively quantify lipids related to insulin resistance in both the liver and serum. RESULTS: The same lipids were detected in the liver and serum but with different intensities between mice. The intensity of DAGs and fatty acids was higher in the diabetic than that in the prediabetic liver. Imaging of liver tissue showed a more compact density of prediabetic (non-fatty) than diabetic liver with DAG remodelling in diabetes. DAGs, which are greatly increased in diabetic serum, were successfully detected and quantified already in prediabetes. CONCLUSION: MeV TOF-SIMS applied to the serum presents an excellent tool for in vivo monitoring of disease development over time.

De novo expression of transfected sirtuin 3 enhances susceptibility of human MCF-7 breast cancer cells to hyperoxia treatment.

Sirtuin 3 (Sirt3) has a promising role in cancer tumourigenesis and treatment, but there have been controversies about its role as oncogene or tumour suppressor in different types of cancer. Changes in its expression are associated with the excessive production of reactive oxygen species (ROS), thus contributing to mitochondrial dysfunction and age-related pathologies. Hyperoxic treatment (i.e. generator of ROS) was shown to support some tumourigenic properties, but finally suppresses growth of certain mammary carcinoma cells. Due to strikingly reduced Sirt3 level in many breast cancer cell lines, we aimed to clarify the effect of de novo Sirt3 expression upon hyperoxic treatment in the human MCF-7 breast cancer cells. De novo expression of Sirt3 decreased metabolic activity and cellular growth of MCF-7 cells, reduced expression of proangiogenic and epithelial mesenchymal transition genes, induced metabolic switch from glycolysis to oxidative phosphorylation, and decreased abundance of senescent cells. These effects were enhanced upon hyperoxic treatment: induction of DNA damage and upregulation of p53, with an increase of ROS levels followed by mitochondrial and antioxidant dysfunction, resulted in additional reduction of metabolic activity and inhibition of cellular growth and survival. The mitigation of tumorigenic properties and enhancement of the susceptibility of the MCF-7 breast cancer cells to the hyperoxic treatment upon de novo Sirt3 expression indicates that these factors, individually and in combination, should be further explored in vitro and particularly in vivo, as an adjuvant tumour therapy in breast cancer malignancies.

Diminished Resistance to Hyperoxia in Brains of Reproductively Senescent Female CBA/H Mice.

BACKGROUND We have explored sex differences in ability to maintain redox balance during acute oxidative stress in brains of mice. We aimed to determine if there were differences in oxidative/antioxidative status upon hyperoxia in brains of reproductively senescent CBA/H mice in order to elucidate some of the possible mechanisms of lifespan regulation. MATERIAL AND METHODS The brains of 12-month-old male and female CBA/H mice (n=9 per sex and treatment) subjected to 18-h hyperoxia were evaluated for lipid peroxidation (LPO), antioxidative enzyme expression and activity - superoxide dismutase 1 and 2 (Sod-1, Sod-2), catalase (Cat), glutathione peroxidase 1 (Gpx-1), heme-oxygenase 1 (Ho-1), nad NF-E2-related factor 2 (Nrf2), and for 2-deoxy-2-[18F] fluoro-D-glucose (18FDG) uptake. RESULTS No increase in LPO was observed after hyperoxia, regardless of sex. Expression of Nrf-2 showed significant downregulation in hyperoxia-treated males (p=0.001), and upregulation in hyperoxia-treated females (p=0.023). Also, in females hyperoxia upregulated Sod-1 (p=0.046), and Ho-1 (p=0.014) genes. SOD1 protein was upregulated in both sexes after hyperoxia (p=0.009 for males and p=0.011 for females). SOD2 protein was upregulated only in females (p=0.008) while CAT (p=0.026) and HO-1 (p=0.042) proteins were increased after hyperoxia only in males. Uptake of 18FDG was decreased after hyperoxia in the back brain of females. CONCLUSIONS We found that females at their reproductive senescence are more susceptible to hyperoxia, compared to males. We propose this model of hyperoxia as a useful tool to assess sex differences in adaptive response to acute stress conditions, which may be partially responsible for observed sex differences in longevity of CBA/H mice.

Unsupervised segmentation of low-contrast multichannel images: discrimination of tissue components in microscopic images of unstained specimens.

Low-contrast images, such as color microscopic images of unstained histological specimens, are composed of objects with highly correlated spectral profiles. Such images are very hard to segment. Here, we present a method that nonlinearly maps low-contrast color image into an image with an increased number of non-physical channels and a decreased correlation between spectral profiles. The method is a proof-of-concept validated on the unsupervised segmentation of color images of unstained specimens, in which case the tissue components appear colorless when viewed under the light microscope. Specimens of human hepatocellular carcinoma, human liver with metastasis from colon and gastric cancer and mouse fatty liver were used for validation. The average correlation between the spectral profiles of the tissue components was greater than 0.9985, and the worst case correlation was greater than 0.9997. The proposed method can potentially be applied to the segmentation of low-contrast multichannel images with high spatial resolution that arise in other imaging modalities.

The role of 17ß-estradiol in the regulation of antioxidant enzymes via the Nrf2-Keap1 pathway in the livers of CBA/H mice.

AIMS: We aimed to explore the impact of surgical 17ß-estradiol (E2) deprivation/administration on the expression of antioxidant enzymes with an emphasis on the alteration of the NF-E2-related factor 2/Kelch-like ECH-associated protein 1 (Nrf2/Keap1) pathway under physiological conditions in the livers of CBA/H mice of both sexes. MAIN METHODS: Hepatic oxidative stress markers were determined by measuring lipid peroxidation and DNA damage using the comet assay. The expression and activities of two isoforms of superoxide dismutase (Sod-1, Sod-2) and catalase (Cat) were studied using real-time PCR, Western blot and spectrophotometrical analyses. The effect of E2 on Nrf2/Keap1 protein levels and localization was assessed using cytosolic and nuclear fractions. KEY FINDINGS: We demonstrate the E2-mediated repression of the antioxidant enzymes Sod-1, Sod-2 and Cat in the livers of ovariectomized mice treated with E2 and its association with a decreased level of Nrf2/Keap1 proteins in the nucleus. We observed beneficial effects of long-term E2 administration on lipid peroxidation but not on DNA damage in the livers of ovariectomized mice. SIGNIFICANCE: The results of this study may additionally confirm the protective ability of E2 in prolonging the onset of age-related disease in females that ultimately contributes to their longer lifespan.

Mononucleotide repeats in the SMAD4 gene promoter in colon carcinoma tissue of Croatian patients.

This study was aimed at the analysis of mononucleotide repeats -462T(15) and -4T(12) in the SMAD4 gene promoter in sporadic colon adenocarcinoma tissue of Croatian patients. The analysis has included 60 pairs of samples of colon tumor and adjacent normal tissue. The number of thymidines in the tracts -462T(15) and -4T(12) of the SMAD4 gene promoter was determined by PCR with fluorescently labeled primers followed by the analysis of obtained DNA fragments by capillary electrophoresis. In the normal colon tissue two haplotypes were present: -462T(15)/-4T(12) in 51 patients (85%) and -462T(16)/-4T(12) in 9 patients (15%). Among the cases with haplotype -462T(15)/-4T(12) detected in normal colon tissue, in 5 cases (8%) malignant tissue displayed different haplotypes: 462T(10)/-4T(10), -462T(12)/-4T(12), 462T(13)/-4T(11), -462T(14)/-4T(10) and -462T(15)/-4T(11). Haplotype -462T(14)/-4T(10) was previously found to be associated with significantly decreased SMAD4 gene promoter activity in comparison to the wild type, while the other detected haplotypes remain to be functionally characterized. This study has shown that functionally relevant somatic alterations of the SMAD4 gene promoter are found in some colon cancer tumors. Although not as frequent in colon as in pancreatic cancer, they may be of significance for certain cases and their role in colon tumorigenesis should be investigated further.

Female headstart in resistance to hyperoxia-induced oxidative stress in mice.

Increased oxygen concentration (hyperoxia) induces oxidative damage of tissues and organs. Oxygen toxicity in hyperoxia is controlled by factors such as sex, age, tissue, strain and hormones. In most species females show lower incidence of some age-related pathologies linked with oxidative stress, which has been attributed to a beneficial effect of ovarian hormones. In this study we found that hyperoxia induced hepatic oxidative damage exclusively in male CBA/H mice, followed by their decreased survival. Histopathological examination revealed that the observed differences in survival were not the consequence of acute lung injury induced by hyperoxia. Next, we observed that an increased Sirt1 protein level in hyperoxia-exposed female CBA/H mice correlated with their lower PPAR-γ and higher eNOS and Sod2 protein levels. In males, higher PPAR-γ and lower Sod2 protein levels were associated with unchanged Sirt1 expression. Although these results are of a correlative nature only, they clearly show that females show better survival, increased resistance to hyperoxia and have generally more efficient defense systems, which suggests that their headstart in resistance to hyperoxia could be a consequence of the beneficial effect of ovarian hormones.

Alzheimer's disease and type 2 diabetes: the association study of polymorphisms in tumor necrosis factor-alpha and apolipoprotein E genes.

Type 2 diabetes (T2D) and Alzheimer's disease (AD) are two progressive disorders with high prevalence worldwide. Polymorphisms in tumor necrosis factor-alpha (TNF-α) and apolipoprotein E (ApoE) genes might be associated with both T2D and AD, representing possible genetic markers for the development of the AD in subjects with T2D. The aim was to determine ApoE and G-308A TNF-α gene polymorphisms in unrelated Croatian Caucasians: 207 patients with sporadic AD, 196 T2D patients and 456 healthy controls. Patients with AD had higher frequency of ApoE4 allele compared to T2D patients and controls. The significant association, observed between ApoE2 allele and T2D, disappeared after the data were adjusted for age and sex. The genotype or allele frequencies of G-308A TNF-α gene polymorphism were similar among the patients with AD, T2D and healthy controls. In conclusion, these results do not support the hypothesis that the A allele of G-308A TNF-α gene polymorphism is associated either with AD or T2D. Our data confirm the association between the ApoE4 allele and AD, and point out the E2 allele of ApoE gene as the possible risk factor for T2D.

Rational variety mapping for contrast-enhanced nonlinear unsupervised segmentation of multispectral images of unstained specimen.

A methodology is proposed for nonlinear contrast-enhanced unsupervised segmentation of multispectral (color) microscopy images of principally unstained specimens. The methodology exploits spectral diversity and spatial sparseness to find anatomical differences between materials (cells, nuclei, and background) present in the image. It consists of rth-order rational variety mapping (RVM) followed by matrix/tensor factorization. Sparseness constraint implies duality between nonlinear unsupervised segmentation and multiclass pattern assignment problems. Classes not linearly separable in the original input space become separable with high probability in the higher-dimensional mapped space. Hence, RVM mapping has two advantages: it takes implicitly into account nonlinearities present in the image (ie, they are not required to be known) and it increases spectral diversity (ie, contrast) between materials, due to increased dimensionality of the mapped space. This is expected to improve performance of systems for automated classification and analysis of microscopic histopathological images. The methodology was validated using RVM of the second and third orders of the experimental multispectral microscopy images of unstained sciatic nerve fibers (nervus ischiadicus) and of unstained white pulp in the spleen tissue, compared with a manually defined ground truth labeled by two trained pathophysiologists. The methodology can also be useful for additional contrast enhancement of images of stained specimens.

K-ras and Dpc4 mutations in chronic pancreatitis: case series.

AIM: To assess whether alterations in the K-ras, p53, and DPC4 genes are present in pancreatitis, a potential precancerous condition that can progress to pancreatic adenocarcinoma. To investigate the alterations occurring at hot spots of K-ras (exon 1), p53 (exons 5 and 7), and DPC4 (exons 8, 10 and 11). METHODS: In 10 patients with acute and 22 with chronic pancreatitis, without pancreatic intraepithelial neoplasia (PanIN), DNA was isolated from paraffin embedded tissue samples. The extracted DNA was analyzed by polymerase chain reaction (PCR), restriction fragment length polymorphism (RFLP) analysis, single-strand conformation polymorphism (SSCP) analysis, and DNA sequencing. RESULTS: In acute pancreatitis samples no mutations were found in any of the investigated genes. In 7 out of 22 samples of chronic pancreatitis nucleotide substitution at exon 1 of K-ras (five at codon 12 and two at codon 13) were found. No mutations in p53 (exons 5 and 7) were detected. Two samples had nucleotide substitutions at exons 8 and 11 of DPC4, introducing STOP signal and change in the amino acid sequence, respectively. One chronic pancreatitis sample displayed simultaneous mutations in K-ras (exon 1, codon 12) and DPC4 (exon 8, codon 358). CONCLUSION: Mutations of K-ras and Dpc4 genes can accumulate already in non-malignant, inflammatory pancreatic tissue, suggesting its applicability in monitoring of further destruction of pancreatic tissue and progression into malignancy.

Infrequent alteration of the DPC4 tumor suppressor gene in renal cell carcinoma.

The aim of this study was to investigate the alterations in the DPC4 tumor suppressor gene in renal cell carcinoma (RCC). The study included 32 tumor specimens from Croatian patients with a diagnosis of RCC. Loss of heterozygosity (LOH) was investigated using three specific oligonucleotide primers for the three DPC4 polymorphic markers. Our investigation of mutations in the DPC4 gene was focused on exons 2, 8, 10 and 11. These exons belong to the mad homology domains 1 (exon 2) and 2 (exons 8-11). The presence of previously documented mutation in exons 2 (codon 100), 8 (codon 358), 10 (codon 412), and 11 (codon 493) was investigated by restriction fragment length polymorphism (RFLP) analysis, as a first screening method. Finally, the study was extended to search for any other type of mutation in the four selected exons by single strand conformation polymorphism (SSCP) assay. To increase heterozygosity, all 32 tumor specimens were tested with primers for three polymorphic markers. A total of 30 (94%) were heterozygous (informative). LOH at any of these markers was only revealed in four (13%) of the 30 informative samples. No tumor samples were positive for mutation in the four investigated exons analyzed by RFLP. In addition, no samples showed other types of mutation in denaturing conditions. Genetic alterations were shown only in a minority of patients, probably because mutation analysis of the DPC4 gene has only been partially covered by our work. It seems that exon 2 (belonging to the MH1 domain) and exons 8, 10, 11 (belonging to the MH2 domain) are not altered in RCC. This investigation must be extended on other exons of DPC4 for a better understanding a role of this gene in renal cell carcinoma.

Status of the DPC4 tumor suppressor gene in sporadic colon adenocarcinoma of Croatian patients: identification of a novel somatic mutation.

Loss of heterozygosity (LOH) of loci on chromosome 18q occurs in a majority of colorectal cancers. The DPC4 (Smad4) tumor suppressor gene, located at 18q21.1, may be a predisposing gene for Juvenile Polyposis Syndrome. To investigate alterations of the DPC4 gene in sporadic colon adenocarcinoma, a panel of 60 tumor specimens from Croatian patients was surveyed for evidence of LOH and also for mutations within the entire DPC4 coding region (exons 1-11). Using three pairs of specific primers for the three DPC4 microsatellite repetitive sequences, we investigated the frequency of LOH. The presence of single nucleotide change at restriction sites of specific codons in exons 2, 8, 10, and 11 (which belong to the conserved region of the gene) was examined by RFLP analysis. The investigation was extended to search for any other mutation within the entire coding region of the DPC4 gene by single strand conformation polymorphism (SSCP) analysis. Our results show a high frequency of heterozygosity in 58 of 60 (97%) colon adenocarcinoma samples. LOH at any one of the three flanking markers was observed in 26 (45%) of the 58 informative cases. The loss of one allele of the DPC4 gene was negatively correlated with tumor size; more frequent in smaller tumors (<5 cm) than in larger ones. A mutation was found in exon 11 in only one tumor sample (T18), and the mutation was verified by sequencing. Sequencing demonstrated a novel mutation-a deletion in exon 11 (134-153 del TAGACGAAGTACTTCATACC) of the DPC4 gene in the MH2 domain. These data suggest that inactivation of the DPC4 gene contributes to the genesis of colorectal carcinoma through allelic loss whereas mutation in the coding region of the DPC4 gene is infrequently detected in Croatian patients with A, B or C stages of colorectal cancers.